[Answer] Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut

The Question : Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DN

A) BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

A) What is the objective of this action? 
B) Explain how the gene of interest is introduced into a vector. 
C) You are given the DNA shown below5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
D) A gene M was introduced into
E)coli
cloning vector PBR322 at BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non recombinant to recombinant plasmids.

Solution for the question :
(a) The two different DNA molecules will have compatible ends to recombine. (½ mark) (b) Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into the DNA of the vector.

(c) 2 fragments (½ mark)

5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’

3’ TAAAACTCCTAG 5’.3’GCATTACAGGA 5’

(d) BamH1 site will affect tetracycline antibiotic resistance gene, hence the recombinant plasmids will lose tetracycline resistance due to inactivation of the resistance gene.

Recombinants can be selected from non-recombinants by plating into a medium containing tetracycline, as the recombinants will not grow in the medium because the tetracycline resistance gene is cut.

The correct answer to the question is researched by our moderators and shared with you. You can give feedback by commenting for the answers you think are wrong.

Leave a Reply

Your email address will not be published. Required fields are marked *